Encoding RIP from Elaeis Guaneensis Jacq

Encoding RIP from Elaeis Guaneensis Jacq Detection and expression profiling of two novel transcripts encoding RIP from Elaeis guaneensis Jacq. in Ganoderma boninense interaction 1. Introduction Among several oil-producing plants, oil palm (Elaeis guineensis) is a tropical crop which is exclusively grown for oil production. Its high oil yield is extracted from oil palm’s thick fleshy mesocarp which is extremely rich in oil (80% of dry mass). Furthermore, oil palm has the highest oil production (oil per unit land) compared to other oil-producing plants. The extracted oil has been used widely for several applications including, food, cosmetics, and bio-fuel (Paterson 2007; Murphy 2009; Alizadeh et al. 2013). Among various diseases , the basal stem rot (BSR) is known to be the most serious disease in oil palm (Ho and Nawawi 1985). Furthermore, the BSR is caused by Ganoderma boninense which is considered specifically as a â€Å"white rot fungus†. The lignin is broken by the fungus leaving whitish cellulose exposed (Paterson 2007). The infection process is initiated when the oil palm roots are penetrated by fungal mycelia, which is spread out to the stem bole, after which the trunk eventually collapses (Rees et al. 2009). Malaysia and Indonesia have suffered the most severe losses from the BSR; furthermore, the diseases has been identified in Malaysia several decades ago (Ho and Nawawi 1985; Idris et al. 2004; Rees et al. 2007). Oil palms of different genetic origins have shown to have resistance to BSR. However, the genes involved in the resistance of oil palms against G. Boninense were unknown (Idris et al. 2004; Durand-Gasselin et al. 2005). Recently, few defence related genes were identified in oil palm. The major pathogen on oil palm in Malaysia has been identified as G. boninense Pat. Stem rots of oil palm caused by species of Ganoderma are a major threat to the sustainability of the oil palm production. In this study, we have isolated one cDNA encoding RIP’s EST, from oil palm. Its expression in oil palm root infected by G. boninese; was investigated to shed light on its potential involvement during early disease development. 2. Materials and methods 2.1 Sample preparation A total of 24 six-month-old oil palm seedlings (Elaeis guineensis Jacq., DxP, GH500 series) were purchased from Sime Darby Plantation Sdn. Bhd. (Banting Malaysia) and divided into two groups with 12 seedlings in each group, one of these groups were treated with Ganoderma boninense Pat. Strain PER71, while the remaining group served as controls. Seedlings treated with G.boninense were inoculated by sitting each seedling on rubber woodblock fully grown with G.boninense PER71 while the other group of seedlings were inoculated with fungal surface mulch as described by (Alizadeh et al., 2011). Three biological replicates of the seedlings were harvested from each treatment at 4, 8, 12 wpi, respectively. The leaves, roots and stem cell were frozen in liquid nitrogen and stored at -80 °C (Tan et al., 2013). 2.2 RNA extraction Total RNA was extracted from treated and untreated oil palm root tissues using a modified CTAB method briefly, 0.1 g tissue was ground in liquid nitrogen into a very find powder. The powder was immediately transferred into 1.5 ml extraction CTAB buffer [ 2% (w/v) cetyl trimethyl ammonium bromide, CTAB; 100mM Tris-HCl, pH 8.0; 2M NaCl; 25 mM ethylenediamineteraacetic acid, EDTA; pH 8.0; 2% (w/v) polyvinylpyrrolidone, PVP; and 2% (v/v) ÃŽ ²-mercaptoethanool]. Equal volume of chloroform/isoamylalcohol (24:1, v/v) was added into the tube and centrifuged at 12,857 g for 15 min at 4 °C. The upper layer was transferred into a new tube and equal volume of phenol/chloroform/isoamylalcohol (25:24:1, v/v/v) was added and centrifuged. This step was repeated until a clear supernatant was obtained. The supernatant was adjusted to a final concentration of 2M LiCl, and incubated at 4 °C for overnight, and then centrifuged. The RNA was dissolved in 5ml diethypyrocarbonate (DEPC) – treated water. An equal volume of chloroform/isoamylalcohol was added, mixed, and centrifuged at 12,857 for 30 min at 4 °C. Precipitation of RNA was performed by adding 0.1 vol of 3M sodium acetate (pH 5.2), 2 vol 100% ethanol and incubated at -80 °C for overnight. After centrifugation, the pellet was washed using 70% ethanol and dissolved in 20ul DEPC-treated water. The quality of RNA was examined by using a Nanodrop( BioRad) at 230, 260 and 280 nm. The RNA integrity was examined using 1.5% agarose gel electrophoresis. The RNA was treated with DNase I (Qiagen, USA) following the manufacturer’s instructions. Figure : Total RNA from various treated and untreated oil palm tissues. Lane A: Untreated control seedling. Lane B: Treated seedlings. 1) Leaf. 2) Basal stem. 3) Root 3. Semi-quantitative Reverse transcriptase (RT-) PCR 3.1 Isolation of cDNA Omniscript â„ ¢ Reverse Transcriptase kit (Qiagen Kit) was used for cDNA synthesis by the following kit manuscript. To obtain the sequence of cDNA from oil palm, gene specific primers were designed based on oil palm expressed sequence tag (EST) (Ho, 2010) and RIP’s type I alignments, using primer 3 version 0.4.0(frodo.wi.mit.edu). 3.2 Sequence analysis of cDNA Semi-quantitative Reverse transcriptase (RT-) PCR was performed on EST using PCR machine with Reverse transcriptase enzyme. Equal amounts of RNA (1ug) extracted from control and treated oil palm root samples were converted into cDNA by using the Omniscript two step Reverse Transcription Kit for cDNA Synthesis (Qiagen, USA) following the manufacturer’s instructions. The resulted sequences shown significant similarities to RIP (Naher et al., 2011). 3.3 Expression profiling Expression levels were calculated by Quantity One 1-D Analysis software 4.6.5 (Bio-Rad) according to the manufacturer’s instructions. PCR products were resolved on 1.5%(w/v) agarose gel (1xTAE) with a DNA mass standard marker (MassRuler TM DNA Ladder, Fermentas). The density of the DNA mass standard dilution series was used to generate calibration curve for absolute quantisation of sample bands by linear regression with extrapolation to zero for each experiment. The density of each sample band was then converted to an absolute quantity using the calibration curve. For each sample band was then converted to an absolute quantity using the calibration curve. For each experiment, the relative band quantity obtained by densitometrric analysis was normalized to the value of the internal control (house-keeping gene) bands which were run in parallel. Identification of differentially expressed genes was based on consistent ford-change across experimental replicates relative to untreate d negative control. Fold changes of ≠¥2- fold or ≠¤0.5-fold were considered as significant. 3.4 Statistical analysis A one-way analysis of variance (ANOVA) was used to determine statistical differences (SPSS version 17;SPSS Inc., Chicago, IL). When the ANOVA was significant at P 0.05 the Duncan’s multiple range test was used for means comparison. The t-test was used to compare between group means.(Alizadeh et al., 2011) 4. Results 4.1 sequence analysis EgRIP-1b The partial cDNA of EgRIP-1b (Dr. Ho personal comment) encodes a putative type I ribosome inactivating protein. The partial sequence consists 167 nucleotide residues. (Fig. 2). This sequence has the highest identity with RIP type I from Populus trichocarpa (98%, XP_002328056.1), Hordeum vulgare (90%, AAA32951.1) and Chain A, Structure Of Mutant Rip From Barley Seeds (90%, 4FBA_A). The NODE_77734GT was classified in a RIP-like superfamily. A putative conserved domain of catalytic residues and some RIP family domain were in this sequence, including that it is a member of the RIP superfamily.(Fig. 5) (Naher et al., 2011) M I C E S I R F E R I S E F L A T E F P G S S K P P K TGATGATCTGCGAGTCGATTAGATTCGAACGCATCTCCGAATTTCTTGCTACCGAATTCCCCGGCAGTTCGAAACCCCCTAAA W M P A L E H G W G D L S A A L L R A D A N P D R P F TGGATGCCGGCACTCGAGCACGGCTGGGGAGATCTCTTTGCCGCGTTGCTGCGCGCCGATGCCAATCCCGACCGTCCCTTCA Fig. 2. The nucleotide and deduced amino acid sequences of NODE_77734GT. 4.2 sequence analysis EgRIP-1a The partial cDNA sequence EgRIP-1a (GenBank ID: ) encodes a protein of 17 amino acid. The sequence consists 178 nucleotides (Fig. 3). This sequences has the highest identity with other type I RIPs from Nicotiana tabacum (47%, ABY71831.1), Musa acuminate (47%, ABY71832.1), Alocasia macrorrhizos (47%, ABY71829.1), Agave sisalana (47%, ABY71828.1) (Fig. 6.a) and (Fig. 6.b) M R P T P N F H Y E W S A CAGGATTCCAGCCGAGCTCCTGCGATAGCCGAACTTCTACCACATGCGACCTACTCCAAACTTCCACTACGAGTGGTCTGCTC L S K Q TCTCCAAACAA Fig. 3. The nucleotide and deduced amino acid sequences of EgRIP-1a. Fig. 4: multiple alignment of NODE with other type I RIPs. Amino acid residues that are identical in all sequences are highlighted in black while amino acid residues that are highly conserved are highlighted in gray; dashes represent gaps introduced to maximize the alignment. (a) (b) Fig. 5: Multiple alignment of EgRIP-1a with other RIPs. The protein sequences and their accession numbers used for analysis of detected sequence. a) Nucleotide residues that are highly conserved are highlighted in gray; dashes represent gaps introduced to maximize the alignment. b) Amino acid residues that are identical in all sequences are highlighted in black with amino acid residues that are highly conserved are highlighted in gray; dashes represent gaps introduced to maximize the alignment. 4.3 Expression profiles (of RIP) in oil palm root upon Ganoderma inoculation A total of 2 cDNA sequences encoding putative defence-related proteins from oil palm were chosen for gene expression profiling in this study. A relative semi-quantification of EgRIP-1b and EgRIP-1b transcripts were performed by calibrating the expression of each gene with an endogenous control, actin. Fig.6 Shows the relative expression level of EgRIP-1b in roots and basal stems in response to the inoculation of G. boninense at different time points compared with that of negative control plants. In G. boninense-treated plants, the gene expression of EgRIP-1b in oil palm roots at 2 wpi was induced. The expression level were n- and n-fold of the uninfected root tissues at 8 and 12 wpi, respectively.(Naher et al., 2011) The expression level was studied in 3 replication of each sample, there were no significant (P>0.05) differences in expression levels in inoculated plants (Alizadeh et al., 2011). EgRIP-1a was up-regulated n-fold and n-fold at X wpi, respectively; before the transcript level decrease at Y wpi in oil palm root tissue following G.boninense infection (Fig). EgRIP-1a expression level were m-, m- and m-fold of the uninfected basal stem tissues at 2,4, 8 and 12 wpi, respectively. EgRIP-1b and EgRIP-1a were not expressed in time zero, untreated samples and leaf tissues. (I) diseased (II) healthy (a) (b) (c) Fig. 6. Differential expression of EgRIP-1b in variety tissues in response to I) G.boninese treatment compare to those in II )control.. a) root tissue, b) stem cell tissue, c) standard (Rippmann et al., 1997) a) b) Fig. 7. Expression level mean in each biological replicate a) in root; b) in stem (I) diseased (II) healthy (a) (b) (c) Fig. 8. Differential expression of EgRIP-1a in variety tissues in response to I) G.boninese treatment compare to those in II) control.. a) root tissue, b) stem cell tissue, c) leaf tissue d)control (Rippmann et al., 1997) a) b) Fig. 9. Expression level mean in each biological replicate a) in root; b) in stem Fig. 10. Semi-quantification of oil palm EgRIP-1a and EgRIP-1b expression levels in root tissues at 2-12 week after inoculation with G.boninense. Significant up-regulation of gene expression compared to untreated negative control. References Alizadeh F, Abdullah SNA, Chong PP, Selamat A Bin (2013) Expression Analysis of Fatty Acid Biosynthetic Pathway Genes during Interactions of Oil Palm (Elaeis guineensis Jacq.) with the Pathogenic Ganoderma boninense and Symbiotic Trichoderma harzianum Fungal Organisms. Plant Molecular Biology Reporter. doi: 10.1007/s11105-013-0595-y Durand-Gasselin T, Asmady H, Flori a, et al. (2005) Possible sources of genetic resistance in oil palm (Elaeis guineensis Jacq.) to basal stem rot caused by Ganoderma boninenseprospects for future breeding. Mycopathologia 159:93–100. doi: 10.1007/s11046-004-4429-1 Ho YW, Nawawi A (1985) Ganoderma boninense Pat . from Basal Stem Rot of Oil Palm ( Elaeis guineensis ) in Peninsular Malaysia. Pertanika 8:425–428. Idris AS, Kushairi A, Ismail S, Ariffin D (2004) SELECTION FOR PARTIAL RESISTANCE IN OIL PALM PROGENIES TO Ganoderma BASAL STEM ROT. Journal of Oil Palm Research 16:12–18. Murphy DJ (2009) Oil palm: future prospects for yield and quality improvements. Lipid Technology 21:257–260. doi: 10.1002/lite.200900067 Paterson R (2007) Ganoderma disease of oil palm—A white rot perspective necessary for integrated control. Crop Protection. doi: 10.1016/j.cropro.2006.11.009 pilotti CA (2005) Stem rots of oil palm caused by Ganoderma boninense: Pathogen biology and epidemiology. Mycopathologia 159:129–137. Rees RW, Flood J, Hasan Y, et al. (2009) Basal stem rot of oil palm ( Elaeis guineensis ); mode of root infection and lower stem invasion by Ganoderma boninense. Plant Pathology 58:982–989. doi: 10.1111/j.1365-3059.2009.02100.x Rees RW, Flood J, Hasan Y, Cooper RM (2007) Effects of inoculum potential, shading and soil temperature on root infection of oil palm seedlings by the basal stem rot pathogen Ganoderma boninense. Plant Pathology. doi: 10.1111/j.1365-3059.2007.01621.x Tan Y-C, Yeoh K-A, Wong M-Y, Ho C-L (2013) Expression profiles of putative defence-related proteins in oil palm (Elaeis guineensis) colonized by Ganoderma boninense. Journal of plant physiology. doi: 10.1016/j.jplph.2013.05.009

Astronomy Rules :: Essays Papers

Astronomy Rules Mars would make a lousy host for the Winter Olympics. Yes, there's the lack of air to consider. But more important, Martian snow turns out to be rock hard. Worse, it is melting away at an alarming rate. In fact, Mars may be in the midst of a period of profound climate change, according to a new study that shows dramatic year-to-year losses of snow at the south pole. It is not yet clear, though, if the evidence of a single year's change represents a trend. But the study provides a surprising new view of the nature of the southern ice cap, said Michael Caplinger of Malin Space Science Systems. "It's saying that the permanent cap isn't quite so permanent as we thought," Caplinger said in a telephone interview. A second study of both poles finds that Red Planet snow is more dense and hard than the euphemistic "packed powder" advertised by Eastern ski resorts, and nothing like the soft flakes expected in Utah for the 2002 Olympics. Instead, it's hard as ice. Though unrelated, the two studies were based on observations made by NASA's Mars Global Surveyor and both will be published in the Dec. 7 issue of the journal Science. The combined observations represent an exciting new way to look at Mars' atmosphere and how it interacts over time with the polar caps and even soil at mid-latitudes, said David A. Paige, a researcher at the University of California, Los Angeles. "The new data are showing what's going on on Mars seasonally as well as on interannual time scales in much more detail than we had with previous observations," Paige told SPACE.com. Where the snow is Both of Mars' polar regions are covered in permanent caps of ice. Scientists have known since the 1970s that some of the ice in the north is water ice. There may be water ice in the south, too, but there is no firm evidence. Both poles are covered in a veneer of carbon dioxide ice, popularly called "dry ice" here on Earth. Each cap grows during its winter and recedes in summer. The research into snow density, lead by David E. Smith of NASA's Goddard Space Flight Center, confirm that much of the Martian snow is in fact composed of carbon dioxide. The study involved more than 400 million elevation measurements spanning more than one Martian year, from February 1999 through May of 2001. The orbiting spacecraft bounced a beam of laser light to the surface and back, recording the round-trip time to determine elevations within 4 inches (10 centimeters).

My Personal Goals

Every successful person has a list of values, visions, and goals. I live by my values, make decisions with my visions in my mind, and set goals that will help me reach my life visions. These three elements take me to places I want to be in life. These elements reflect achievement goals and performance goals. â€Å"Achievement goals reflect the purpose of an individual's achievement pursuits and two general types have been proposed: mastery and performance. When pursuing mastery goals, an individual's purpose is to develop competence by acquiring new knowledge and skills (e. . , â€Å"My goal in this class is to understand the material as thoroughly as possible. â€Å"). When pursuing performance goals, an individual's purpose is to demonstrate competence relative to others (e. g. , â€Å"My goal in this class is to do better than other students. â€Å"). Thus, individuals can be motivated to achieve for two very different reasons: to increase their competence by learning as much as they can or to gain favorable judgments of their competence by performing as well as they can compared to others. † (Barron & Harackiewicz, 2001, p. 06) My achievement goals and performance goals are family, career, and education. These three categories intergrade within one another. My education goal is to obtain my Bachelors of Science in nursing degree. My career goal relies on the completion of my degree to continue to advance in my career. My family goal is to maintain a healthy, happy, well-balanced structure while perusing and achieving my other goals. â€Å"Professional life has a great impact on the personal life of a person. If one is neglected, then, the other aspect will be hampered. So, a proper scale of balance must be maintained. (Kar, 2011, p. 11) Throughout life as values and visions change and goals are attained, new goals arise. Education is my new goal. My vision for my career path has given me the value to achieve a Bachelors of Science in nursing degree. I have chosen to attend â€Å"University of Phoenix† online to help maintain family balance and life visions. I believe â€Å"University of Phoenix† design courses to help meet and maintain my education short-term goals and to stay on track with meeting my long-term education goal. My short-term goals include completing and passing every course. Within my short-term goals there are milestones. The milestones are laid out in class discussions and smaller assignments. The large assignments and group projects will be part of my short-term goals for that course. I will divide my large assignments into milestones. Completion of each milestone within that assignment I will reevaluate the progress and continue to move forward until milestones are meant and assignments successfully completed prior to due date. Meeting these milestones will help me reinforce my commitments as I continue to advance forward. My education goal is a new goal because of my change in careers. I had been a trauma nurse since 2003. Working in the emergency department I demonstrated leadership skills, personal accountability, and professionalism by exchanging ideas and feedback while embracing opportunities for change. October 2013, I was approached to apply for an administration position and accepted the offer. One requirement for the position is to obtain my BSN, in addition to a short-term goal for my career so I can continue advancing forward in my career path. My current position has directed me to the following pathways. Improve efficiencies with nursing processes, reduction of readmission rates, increase satisfaction scores with pain management and develop outreach programs for patients with chronic disease. I have individual visions for each pathway. Every pathway goes in different directions. It is important to maintain clear vision and focus on every pathway individually. I have short-term goals that help me reach my visions. I rely heavily on team approach to meet goals with exceptional outcome. I facilitate each team; the team plans the short and long-term goals for the projects. Within the short-term goals there are milestones with due dates. Progress and barriers are addressed at scheduled meetings. The process drives timing, communication, and progress. To maintain balance among my family, work, education, and free time, I will use several tools. A planner lays out timing to achieve short-term goals and record milestones. My educational time is early morning and late evening studies; dividing my educational time helps maintain balance with family needs. The family’s schedule displays in the kitchen on a calendar whiteboard. The calendar is visible to everyone and lists important activities. My time after work is according to children’s homework, activities, and events. I have set aside eight hours a week for time in the gym, which is very important to maintain life balance and reduce stress. At work I have to use different tools. Outlook calendar displays my meetings and events. A whiteboard is in my office where I list projects. This list creates visual details of ilestones, due dates, and target completion dates. Completed projects are kept track of in an excel spreadsheet to monitor success or barriers. Projects are officially titled successful when measureable outcome demonstrates effectiveness, efficiency and increase productivity. In conclusion, I will attain my educational goal by achieving my BSN degree. My short- term career goals are to continue to complete projects with exceptional outcome. My long- term goa l is to continue advancing in a successful career path. I understand I have to sacrifice things to allocate for new goals. I know scheduling time each day to work on my goals is a key to my success. To reach my goals I understand I cannot allow excuses. I know it will be critical to stay on task and to do what needs to be accomplished every day. â€Å"Human progress is neither automatic nor inevitable. Every step toward the goal requires sacrifice, suffering, and struggle; the tireless exertions and passionate concern of dedicated individuals. † (King, 2001-2013, p. 1)

Middle Ages and Impact of Religion essays

Middle Ages and Impact of Religion essays There is no stronger association in history than between the Middle Ages and religion. It seems that there is no work of history written during or since that does not make this connection. The faiths of the middle ages were the source of great triumph and great strife. There is no point where religion does not play a part from politics and law to individuality. The historical impression is one of countless individuals living and dying for their faith. Within the context of the Middle Ages there are three main faiths that all impacted the lives people and the reality of institutions and governments, Christianity, Islam and Judaism. This work will briefly address the impact and importance of all three faiths within the context of the Middle Ages. The foundational effects of religion upon the Middle Ages did not simply begin at the mark of the era change, whatever date is used. The importance of faith travels backward for almost as long as the records of history. People have eternally been searching and seeking the answers to unanswerable questions about the origin of all things but most importantly Religion consists in the endeavor of men to cultivate and express those qualities which are inherent in the nature of Man the Eternal, and to have faith in himwithin us there is a current of tendencies which runs in many ways in a contrary direction, the life current of universal humanity. Religion has its function in reconciling the contradiction, by subordinating the brute nature to what we consider as the truth of Man. (Tagore 142) The structured answers to these questions became what we now call religion Religion and faith have always been strong in man and in the Middle Ages the differences between these faiths seems to have reached a pitch beyond most seen before. Most importantly it was at this time that faith...

Laws and Rules in State Licensing and Public Policy Essays

Laws and Rules in State Licensing and Public Policy Essays Laws and Rules in State Licensing and Public Policy Essay Laws and Rules in State Licensing and Public Policy Essay Laws and Rules in State Licensing and Public Policy Name: Course: Date: Alabama The state of Alabama has specific laid down guidelines on how to recruit professional counselors. The Alabama Recovery Center is the main health facility that offers mental health treatment in the state of Alabama and works closely with the Alabama Board of Examiners in Counseling (ABEC) that conducts counseling examinations within the state. The requirements for counselor certification and licensure are different and are outlined based on educational background and the professional experience of the applicant. A).The Scope of Counseling and the Criteria for Becoming a Licensed Professional Counselor According to Alabama Recovery Center (2012), the types of counseling offered in Alabama deal with chronic pain, substance abuse, marriage/couples, grief and loss, abuse/trauma, depression, Fibromyalgia and anxiety. In chronic pain counseling, the Alabama Recovery Center provides individual and group pain counseling with the help of the Behavioral Science Department of Alabama Pain Center. Substance abuse counseling is divided into three phases namely intensive outpatient program, after care and custom care. According to the Alabama Board of Examiners in Counseling (2012), the requirements for one to be recognized as a licensed professional counselor in the state of Alabama are: A pass score in one countrywide counselor examination. Either the NCE or the NCMHCE. A post graduate degree in counseling, family therapeutics, community service and any psychological subject attained from a recognized institution. Non-refundable application fee of $200.00 payable to the Alabama Board of Examiners in Counseling and a recent photograph. Course of study form sent directly from relevant educational institution. 2 recommendations from clinical counseling supervisors. Attained 3000 hours of master’s supervised knowledge in trained counseling done over one year supervised by a psychology expert, or a licensed professional counselor done for at least 100 hours. Finish 60 master’s session hours in counseling at a recognized college or university within the state. B).Distinction between Licensure, Certification and Accreditation a). Certification Certification is the first process through which the competence of counseling students is recognized. After certification, the student counselor can legally adopt the title of a certified counselor. In the state of Alabama, counselor certification is carried out by the Alabama Board of Examiners in Counseling that is delegated by the governor of Alabama. b). Licensure This is a way of regulating the standards of certified counselors. Licensure is different from state to state unlike certification that is standard across all states. Counseling institutions also have to be granted licenses to legalize their operations. Licenses can be revoked in cases where the counselor or counselor training institutions are found to be acting in violation of professional counseling guidelines. c). Accreditation Through this process, institutions that educate counselors are recognized by higher organizations and issued certificates (CACREP 2013).Examples of national accrediting bodies include Council for Accreditation of Counseling and Related Educational Programs (CACREP), the Council on Rehabilitation Education (CORE) and the Council on Higher Education Accreditation (CHEA). Examples of accredited counseling institutions in the state of Alabama include Alabama State University, Auburn University, South University-Montgomery, Faulkner University, Jacksonville State University and Gadsden State Community College. C). Code of Ethics and Standards of Practice for Licensed Professional Counselors in Alabama The Alabama Counseling Association code of ethics is divided into eight main chapters that address counseling relationship, confidentiality, privileged communication and privacy, professional responsibility, relationships with other professionals, evaluation, assessment and interpretation, supervision, training and teaching, research and publication and resolving ethical issues. The counseling relationship section outlines the primary responsibility of the counselor, describes counseling plans, discourages any form of discrimination, sexual intimacy with client or colleague and defines client rights. The confidentiality section describes client right to privacy, groups and families, minor or incompetent clients and consultation. The professional responsibility chapter describes professional competence, advertising and soliciting clients, credentials and responsibility to other professionals. The chapter on evaluation, assessment and interpretation describes the competence to use and interpret tests, informed consent, test selection and test construction. Training and supervision describes roles of counselor educators (Alabama Counseling Association 2010). Standards of practice are described in the code of ethics as representing minimal behavioral statements of the code of ethics. Standard of Practice one (SP-1), is about avoiding harm to clients, Standard of Practice two (SP-2) emphasizes on nondiscrimination .The last Standard of Practice, (SP-56) is about cooperation with investigative committee. D). the Concept of Core Provider Status The core provider is the professional entity allotted the task of equipping a facility or group of facilities with vital operating materials and services. This concept is usually employed by companies, organizations or institutions that require periodical provisions of different materials to be able to run smoothly. Among this wide variety of institutions are medical institutions that require consistent provision of drugs and medical tools and materials to be able to dispense their services to patients. This concept has enabled health institutions to operate for long periods without stopping because there are usually enough materials needed to run these facilities. When there is a shortage of a particular material, the core provider is notified in time so that they are able to acquire the material and deliver it to the health institution in time. Some health institutions core providers, depending on their capacity, provide materials to more than one institution therefore enhancing the efficiency of health facilities. With such consistent, reliable provision of materials to health facilities, most if not all health facilities are able to operate for a whole year without having to shut down because of insufficient materials. This consequently buffers the accessibility of health services to citizens. The task of funding mental health services has for a long time been a responsibility of the American government. Over the years, private providers have also come aboard to supplement provisions made by the government to mental health facilities. Public sector financing for mental health services include Medicaid, Medicare and other public programs initiated by the government. On the other hand, private sector funding includes private insurance coverage, outs of these interactions are public-private interactions, public payer interactions and behavioral and social services interactions (The Kaiser Commission on Medicaid and the Uninsured 2011). E). Public Policies of Mental Health Services Because mental challenges affect may people in the United States, it is crucial that efficient policies are made to govern the operations of mental health facilities. Public policies should be created with the sole aim of bettering the services provided to people with mental challenges. Results of a research conducted by mental health analysts have suggested that improving the social conditions of people does eliminate the chances of mental problems by a huge percentage. Those at most risk of being mentally challenged are the people who are ranked lowest in financial capability. Consequently, better living conditions translate to better mental health status. Policy makers on mental health should urge the government to improve the social well being of people as the first attempt towards reducing the occurrence of mental health problems. Education, housing, income and poverty levels should be critical pointers to mental health public policy formulators. Public policies, mainly formulated by the government, should ensure that the available funding is channeled first towards those in low-income brackets. Mental health policy makers should also create a direct link with educational institutions to first improve standards of education in a bid to improve the mental capabilities of pupils and students. In ensuring that the proper policies are made towards solving mental health problems, advocacy has to be embraced in exposing the current statistics of mental health problems and how these figures can be reduced. The general components of advocacy in mental health policy formulation are awareness-raising, information, education and training provision, mutual help, counseling, mediating between and defending mental health patients. In conclusion, professional counseling in Alabama is at an advanced stage with efficient struc tures and institutions in place. Counselors conduct their duties within the limits of the professional counselors’ codes of ethics and other stipulations put in place by national associations. Advocacy is important in decoding general misconceptions about mental health problems. References Alabama Board of Examiners in Counseling. (2012). Application to the Alabama Board of Examiners in Counseling. In Alabama Board of Examiners in Counseling. Retrieved from abec.alabama.gov/LPC.htm Alabama Counseling Association. (2010). Code of Ethics and Standards of Practice. In Alabama Counseling Association. Retrieved from alabamacounseling.org/ethics.html Alabama Recovery Center. (June 2, 2012). Our Services. In Covenant Health Centers.Retrieved from covenanthealthcenters.com/alabama-recovery-center/our-services/ Council for Accreditation of Counseling and Related Educational Programs .(2013) What is Accreditation.Accreditation Basics.In Council for Accreditation of Counseling and Related Educational Programs. Retrieved from cacrep.org/index.cfm/what-is-accreditation The Kaiser Commission on Medicaid and the Uninsured. (April 2011). Mental Health Financing in the United States. A Primer. Washington. The Kaiser Family Foundation.

Policies Needed to Improve Healthcare Quality Research Paper

Policies Needed to Improve Healthcare Quality - Research Paper Example In turn, many Americans are hurting since the medicine-linked care system is also suffering. The major contributors of the problems within the healthcare systems include poor training of the clinicians, ineffective delivery of care and poor quality of the services offered (Chassin and Robert, 1998). In accordance to John M. Luce, Andrew B. Bindman and Philip R. Lee (1994), healthcare quality has always been measured using various ideologies and facts. These facts include taking note of fundamental aspects in the healthcare sector. These things encompass taking note of patient’s satisfaction, therapeutic procedures involved and diagnostic methods applied. History has it that healthcare’s low quality may have its roots way back in the 19th century. Whereby, during this time, medicine sector in America was in the control of profit making institutions. Moreover, under the same organizations, the medicine world was disorganized and lacked high standard quality. In light of this, an organization was pioneered to retrieve ownership and control of the medicine sector from the profit-minded organizations. This organization was known by the name American Medical Association. In the early 1900s, a man by the name Ernest Codman saw it fit to make contacts with treated patients to inquire of their satisfaction with the healthcare services. However, many ignored this action and led to the increased poor quality of the healthcare sector. In addition to his call for inquiry of the satisfaction, Codman also made various suggestions that would help salvage the deteriorating healthcare quality. However, just like before, most people in the healthcare sector ignored and led to the increasing low quality of the medical services. These suggestions included organization of the hospital staff, tracking and keeping medical records, forming medical rules and regulations and making supervised diagnosis. Over the

The Impact of Logistics and Supply Chain on Maritime Transportation Research Proposal

The Impact of Logistics and Supply Chain on Maritime Transportation - Research Proposal Example Logistics and supply chain has emerged from being a supporting service for businesses to a mainstream service for businesses across the globe. The maritime industry has also adopted new concepts of logistics and supply chain and has been benefitted by the use of the new concepts and methodologies of logistics. The modern day maritime transportation industry has become an avid user of logistics and supply chain and has been constantly transforming it to meet the emerging needs of the global business environment through the effective use of supply chain management and logistics activities. In this respect, many challenges and opportunities are created by logistics and supply chain in this mode of transportation. Also, there have been numerous positive benefits and some negative impacts of supply chain and logistics on maritime transportation as an important industry. The main objective of the research is to find out the positive and negative impacts of the logistics and supply chain in the maritime transportation sector. The secondary objectives of the research works are to understand how the maritime transportation industry is affected by the evolution of the logistics and supply chain management in the industry and how the use of new concepts and technologies in this industry has led to the creation of new opportunities as well as challenges for the maritime transportation industry. The research questions are formulated to find out what the research paper wants to answer through the study. Research questions form the basis of the direction of the study and also help in selecting a proper research methodology and design of the research paper. The research questions for this study are selected and prepared on the basis of the scopes of the research and the primary objectives of the research. Since, the main objective of this research paper is to identify and evaluate the various positive as well as